You are seeing this message because your Web browser does not support basic Web standards. Find out more about why this message is appearing and what you can do to make your experience on this site better.


ABOUT ARCHIVES
Advanced Search

Welcome   | My Account | E-mail Alerts | Access Rights | Sign In


  Vol. 156 No. 6, June 2002 TABLE OF CONTENTS
  Archives
  •  Online Features
  Article
 This Article
 •Abstract
 •PDF
 •Send to a friend
 • Save in My Folder
 •Save to citation manager
 •Permissions
 Citing Articles
 •Citation map
 •Citing articles on HighWire
 •Citing articles on Web of Science (21)
 •Contact me when this article is cited
 Related Content
 •Related article
 •Similar articles in this journal
 Topic Collections
 •Pediatrics, Other
 •Alert me on articles by topic
 Social Bookmarking
  Add to CiteULike Add to Connotea Add to Del.icio.us Add to Digg Add to Reddit Add to Technorati Add to Twitter What's this?

Polymorphisms for Interleukin 1ß Exon 5 and Interleukin 1 Receptor Antagonist in Taiwanese Children With Febrile Convulsions

Fuu-Jen Tsai, MD, PhD; Yao-Yuan Hsieh, MD; Chi-Chen Chang, MD; Cheng-Chieh Lin, MD; Chang-Hai Tsai, MD, PhD

Arch Pediatr Adolesc Med. 2002;156:545-548.

ABSTRACT

Objective  To investigate whether interleukin 1ß (IL-1ß) exon 5 and IL-1 receptor antagonist (IL-1Ra) gene polymorphisms can be used as markers of susceptibility to febrile convulsions in children.

Methods  Children were divided into 2 groups: those with febrile convulsions (group 1; n = 51) and normal control subjects (group 2; n = 83). Polymorphisms for IL-1ß exon 5 and IL-1Ra gene polymorphisms were detected by polymerase chain reaction. Genotypes and allelic frequencies for IL-1ß exon 5 and IL-1Ra gene polymorphisms in both groups were compared.

Results  Genotype and allele frequencies for IL-1ß exon 5 in both groups were not significantly different. Proportions of E1 homozygotes and E1/E2 heterozygotes for IL-1ß exon 5 were 50 (98.1%) and 1 (1.9%), respectively, in group 1 and 82 (98.8%) and 1 (1.2%), respectively, in group 2. Frequencies of alleles E1 and E2 for IL-1ß exon 5 were 101 (99.0%) and 1 (1.0%), respectively, in group 1 and 165 (99.4%) and 1 (0.6%), respectively, in group 2. Genotype proportions and allele frequencies for IL-1Ra between groups were significantly different. Proportions of genotypes I/I and I/II for IL-1Ra were 49 (96.1%) and 2 (3.9%) in group 1 and 69 (83.1%) and 14 (16.9%) in group 2. Frequencies of alleles I and II for IL-1Ra were 100 (98.0%) and 2 (2.0%) in group 1 and 152 (91.6%) and 14 (8.4%) in group 2.

Conclusions  The IL-1Ra allele I is associated with a higher susceptibility to febrile convulsion, which may become a useful marker for predicting the development of febrile convulsions. The IL-1ß exon 5 gene polymorphisms are not a useful marker for predicting the susceptibility to febrile convulsions.



INTRODUCTION
 Jump to Section
 •Top
 •Introduction
 •Subjects and methods
 •Results
 •Comment
 •Author information
 •References

FEBRILE CONVULSIONS, the most common form of childhood seizures, occur in 2% to 5% of children before the age of 5 years.1 Febrile convulsions are marked by high or rapidly rising fever and short duration; uncomplicated convulsions do not predispose to epilepsy and are not associated with neurologic abnormalities.2 The pathogenesis of febrile convulsions remains obscure. Possible causes include viral infection of the central nervous system and lowered threshold for convulsions in the presence of fever.3 Recently, febrile convulsions have been suggested to be a gene-related disease.4 In fact, febrile convulsions of children involve a complex interaction between the immunoinflammatory process, cytokine activation, and genetic factors.5

Cytokine is a key factor of the host response to infection, and its effects include induction of fever, leukocytosis, and acute-phase protein synthesis.6 Cells from children prone to seizures may produce more proinflammatory cytokines that may induce convulsions or, alternatively, higher levels of anti-inflammatory cytokines as a defense mechanism against seizure.7 Proinflammatory cytokines, including interleukin 1ß (IL-1ß), are known to modulate effects of neurotoxic neurotransmitters discharged during excitation or inflammation in the central nervous system.8 Some cytokine polymorphisms might be related to febrile convulsions, including IL-1{alpha}, IL-1ß, and IL-1 receptor antagonist (IL-1Ra) gene polymorphisms.8 Interleukin 1 belongs to a cytokine family modulating cellular proliferation and has the capacity to induce other cytokines. It is a primary mediator of the inflammatory response and has been shown to induce prostaglandin synthesis.9

The IL-1 genes are associated with several immunoinflammatory diseases.10 The IL-1ß polymorphisms are associated with enhanced production of IL-1ß and the increased risk of both hypochlorhydria induced by Helicobacter pylori and gastric cancer.11 The IL-1ß polymorphisms were related to the regulation of cytokine and growth factor expression in articular chondrocytes and the final development of osteoarthritis.12 Allele E2 in IL-1ß exon 5 was related to an increased risk of erosive arthritis.13 The action of IL-1 is complex and regulated in part by its naturally occurring inhibitor, the IL-1Ra.

Genetic studies of multifactorial diseases such as febrile convulsions are difficult to approach because of the uncertainty of polygenic traits. In our laboratory, we have observed that the IL-1ß-511*T allele could be used as a genetic marker of susceptibility to Kawasaki disease (Yi-Ru Shi, MS, F.-J.T., and C.-H.T., unpublished data, 2001). In contrast, we noted that the IL-1ß (IL-1ß-511 promotor, IL-1ß exon 5) and IL-1Ra were not useful markers to predict susceptibility to endometriosis and rheumatoid arthritis.14 We also noted that the IL-1ß-511 promotor polymorphism is not a useful marker for prediction of the susceptibility to febrile convulsions and epilepsy (F.-J.T., Y.-Y.H., C.-C.C., and C.-H.T., unpublished data, 2001). On the basis of these experiences, we further tried to evaluate whether these polymorphisms are useful markers for predicting susceptibility to febrile convulsions in children.


SUBJECTS AND METHODS
 Jump to Section
 •Top
 •Introduction
 •Subjects and methods
 •Results
 •Comment
 •Author information
 •References

The study included Taiwanese children with febrile convulsions (group 1; n = 51) and normal control subjects (group 2; n = 83). This study was approved by the Ethical Committee of the China Medical College Hospital, Taichung, Taiwan. Informed consent was signed by all parents of the patients who donated their blood. There were nonsignificant differences between the groups in age, weight, and height. The diagnosis of febrile convulsions was made after the exclusion of other causative agents, including bacterial or viral infection.

All children underwent peripheral blood sampling for genotype analyses. Genomic DNA was isolated from peripheral blood by means of a DNA extractor kit (Genomaker DNA extraction kit; Blossom, Taiwan). A total of 50 ng of genomic DNA was mixed with 20 pmol of each polymerase chain reaction (PCR) primer in a total volume of 25 µL containing 10mM Tris hydrochloride, pH 8.3; 50mM potassium chloride; 2.0mM magnesium chloride; 0.2mM each deoxyribonucleotide triphosphate; and 1 U of DNA polymerase (Amplitaq; Perkin-Elmer, Foster City, Calif). Four PCR primers were used to amplify the correlated gene. The sequences of these primers were as following (from 5' to 3' end): IL-1ß exon 5: upstream, GTTGTCATCAGACTTTGACC; downstream, TTCAGTTCATATGGACCAGA; and IL-1Ra: upstream, CTCAGCAACACTCCTAT; downstream, TCCTGGTCTGCAGGTAA. The PCR conditions were as follows: 35 cycles at 94°C for 1 minute, 60°C for 1 minute, and 72°C for 2 minutes, then stand at 72° for 30 minutes and hold at 4°. Biallelic base polymorphisms in exon 5 at position +3953 (IL-1ß+3953) for IL-1ß gene were detected. The IL-1ß+3953 exon 5 polymorphism was analyzed by PCR amplification followed by Taq I restriction analysis.15 The PCR products were directly analyzed for IL-1Ra by electrophoresis on agarose gel, and each allele was recognized according to its size. Allelic frequencies are expressed as a percentage of the total number of alleles. Genotypes and allelic frequencies for IL-1ß and IL-1Ra polymorphisms in both groups were compared.

The SAS system with {chi}2 and Fisher exact test were used for statistical analyses. P<.05 was considered statistically significant.


RESULTS
 Jump to Section
 •Top
 •Introduction
 •Subjects and methods
 •Results
 •Comment
 •Author information
 •References

Genotype proportions and allele frequencies for IL-1ß exon 5 in both groups were not significantly different (Table 1). The most common genotype for IL-1 gene in both groups was E1 homozygote. Proportions of E1 homozygote and E1/E2 heterozygote for IL-1ß exon 5 were as follows: group 1, 98.0% and 1.9%, respectively; group 2, 98.8% and 1.2%, respectively. There were no E2 homozygotes. Allele E1 and E2 frequencies for IL-1ß exon 5 were as follows: group 1, 99.0% and 1.0%, respectively; group 2, 99.4% and 0.6%, respectively (Table 1).


View this table:
[in this window]
[in a new window]
Table 1. Genotypes and Allele Frequency of IL-1ß Exon 5 in Children With Febrile Convulsions and Normal Control Subjects*


In contrast, the genotype proportions and allele frequencies for IL-1Ra between the groups were significantly different. The most common genotype for IL-1 gene in both groups was I/I. Proportions of I/I and I/II for IL-1Ra were as follows: group 1, 96.1% and 3.9%, respectively; group 2, 83.1% and 16.9%, respectively (Table 2). Allele I for IL-1Ra was associated with febrile convulsions. Allele I/II for IL-1Ra was found in the following proportions: group 1, 98.0% and 2.0%, respectively; group 2, 91.6% and 8.4%, respectively (Table 2).


View this table:
[in this window]
[in a new window]
Table 2. Genotypes and Allele Frequency of IL-1 Receptor Antagonist in Children With Febrile Convulsions and Normal Control Subjects*



COMMENT
 Jump to Section
 •Top
 •Introduction
 •Subjects and methods
 •Results
 •Comment
 •Author information
 •References

Cytokines are proteins that play a role in the communication link between the immunologic system and brain tissue. Cytokines are related to leukocyte function and migration, angiogenesis, hematopoiesis, antitumoral effects, and atherosclerosis.16 They are produced by peripheral monocytes and also by astrocytes and glial cells within the central nervous system.17 Cytokines from peripheral-blood mononuclear cells may cross the blood-brain barrier and may thus be involved in the pathogenesis of fever.18

The IL-1 response from sensitized mononuclear cells may have a role in the development of febrile convulsions.3 During the acute phase of febrile convulsions, patients have significantly increased plasma IL-1ß levels, which may be responsible for the pathogenesis of febrile convulsions.18 Differences in the distribution of the biallelic polymorphism in the promotor region of the IL-1ß gene were found among patients exhibiting temporal lobe epilepsy.8 Interleukin 1 also regulates the development of glial scars at sites of central nervous system injury.8 In contrast, Ichiyama et al19 found no correlation between the cytokines tumor necrosis factor {alpha}, IL-1ß, and IL-6 in the cerebrospinal fluid and the presence of febrile seizures.

Genetic factors play a major role in the etiology of febrile convulsions. Cytokine genes may be related to cytokine expression and regulation of the immune-mediated pathogenetic process. Cytokine gene polymorphisms have recently attracted considerable interest because distinct alleles of cytokine genes have been discovered to be associated with different immunoinflammatory diseases.7 Single nucleotide polymorphisms are the most abundant types of DNA sequence variation in the human genome.20 Single nucleotide polymorphism markers provide a new way to identify complex gene-associated diseases such as febrile convulsions in children.

Interleukin 1 exists in 2 forms, IL-1{alpha} and IL-1ß, which are encoded by distinct genes but share the same receptors and biological properties.21 The loci for IL-1{alpha} and IL-1ß are located on the proximal region of the long arm of chromosome 2.22 The IL-1ß polymorphism has been correlated with IL-1ß expression.23 These results indicate that the genotype of the IL-1ß polymorphisms may affect IL-1ß production in an intricate and complicated manner. Different polymorphisms have been described in the IL-1ß gene, and at least 2 of them could influence protein production: one located in the promotor region at position -511 (IL-1ß-511)12 and the other in exon 5.15 In our previous research, we noted the lack of association between febrile convulsions and IL-1ß-511 promotor polymorphism (F.-J.T., Y.-Y.H., C.-C.C., and C.-H.T., unpublished data, 2001). These genes code several proteins that may be key components in the pathogenesis of febrile convulsions.

The IL-1 or IL-1Ra polymorphisms have been found to be related to susceptibility or disease activities for individual diseases, including Alzheimer disease,24 Parkinson disease,25 temporal lobe epilepsy,8 schizophrenia,26 erosive arthritis,13 polymyositis and dermatomyositis,27 multiple sclerosis,28 lymphocytic leukemia,29 atherosclerosis,30 coronary artery disease,31 alcoholic liver disease,32 idiopathic pancreatitis,33 inflammatory bowel disease,34 and IgA nephropathy.35 The regulation of IL-1ß and IL-1Ra may be coordinated during inflammation.36 The level of IL-1ß messenger RNA showed a positive correlation with that of IL-1ß and a negative correlation with the level of IL-1Ra messenger RNA.37

In contrast, some investigators have found no correlation between genetic polymorphisms of IL-1ß and susceptibility to rheumatoid arthritis,13 chronic obstructive pulmonary disease,38 multiple myeloma,39 diabetes mellitus,40 postmenopausal osteoporosis,41 and ischemic heart disease.42 Furthermore, IL-1 genes may have a role in the severity of the disease rather than in susceptibility to the disease itself.10 In our previous study, we also observed an association between disease activity of rheumatoid arthritis and a polymorphic IL-1ß–511*C gene sequence (Chun-Ming Huang, MD, F.-J.T., and C.-H.T., unpublished data, 2001).

The IL-1Ra is structurally related to IL-1{alpha} and IL-1ß and competes with these molecules for occupation of IL-1 cell surface receptors. The presence of the IL-1Ra allele II was associated with enhanced IL-1ß production in vitro.43 The IL-1Ra allele II is associated with a variety of epithelial-related chronic inflammatory diseases including systemic lupus erythematosus,44 psoriasis,45 alopecia areata,46 lichen sclerosus,47 and ulcerative colitis.48 In this study, we observed that the IL-1Ra allele I is associated with higher susceptibility to febrile convulsions. The results further suggest that the IL-1Ra allele II as well as the increased production of IL-1ß might play a role in preventing febrile convulsions. Genotype distributions and allelic frequencies for IL-1Ra gene polymorphism may be the candidate genetic markers in the susceptibility to febrile convulsion. In contrast, the IL-1ß exon 5 gene polymorphism is not useful in predicting the susceptibility to febrile convulsion. This discrepancy may be due to different illness classifications and racial and disease variation.

In conclusion, IL-1Ra is a useful marker for predicting susceptibility to febrile convulsions. In contrast, febrile convulsions are not associated with IL-1ß exon 5 gene polymorphisms. This could provide the database for further survey of the IL-1 and IL-1Ra polymorphisms. However, the real roles of the IL-1 polymorphisms in febrile convulsions remain to be clarified. Furthermore, the impact of other cytokine polymorphisms on development of febrile convulsions merits further study.


What This Study Adds

Interleukin 1ß exon 5 and IL-1Ra may be related to the pathogenesis of febrile convulsions. This study examines the potential usefulness of these markers in predicting susceptibility to febrile convulsions in children. We found that interleukin 1 receptor antagonist is a useful marker for predicting susceptibility to febrile convulsions.



AUTHOR INFORMATION
 Jump to Section
 •Top
 •Introduction
 •Subjects and methods
 •Results
 •Comment
 •Author information
 •References

Accepted for publication February 7, 2002.

Corresponding author and reprints: Fuu-Jen Tsai, MD, PhD, Department of Pediatrics and Medical Genetics, China Medical College Hospital, No. 2 Yuh-Der Rd, Taichung, Taiwan (e-mail: d0704{at}hpd.cmch.org.tw).

From the Departments of Pediatrics and Medical Genetics (Drs F.-J. Tsai and C.-H. Tsai), Obstetrics and Gynecology (Drs Hsieh and Chang), and Family Medicine (Dr Lin), China Medical College Hospital, Taichung, Taiwan.


REFERENCES
 Jump to Section
 •Top
 •Introduction
 •Subjects and methods
 •Results
 •Comment
 •Author information
 •References

1. Wallace RH, Wang DW, Singh R, et al. Febrile seizures and generalized epilepsy associated with a mutation in the Na+-channel beta1 subunit gene SCN1B. Nat Genet. 1998;19:366-370. FULL TEXT | ISI | PUBMED
2. Addy DP. Nosology of febrile convulsions. Arch Dis Child. 1986;61:318-320. FREE FULL TEXT
3. Helminen M, Vesikari T. Increased interleukin-1 (IL-1) production from LPS-stimulated peripheral blood monocytes in children with febrile convulsions. Acta Paediatr Scand. 1990;79:810-816. ISI | PUBMED
4. Johnson EW, Dubovsky J, Rich SS, et al. Evidence for a novel gene for familial febrile convulsions, FEB2, linked to chromosome 19p in an extended family from the Midwest. Hum Mol Genet. 1998;7:63-67. FREE FULL TEXT
5. Vigano P, Gaffuri B, Somigliana E, Busacca M, Di Blasio AM, Vignali M. Expression of intercellular adhesion molecule (ICAM)–1 mRNA and protein is enhanced in endometriosis versus endometrial stromal cells in culture. Mol Hum Reprod. 1998;4:1150-1156. FREE FULL TEXT
6. Florman AL. Interleukin-1 and monitoring of acute infections. Pediatr Infect Dis. 1985;4:450-452. ISI | PUBMED
7. Straussberg R, Amir J, Harel L, Punsky I, Bessler H. Pro- and anti-inflammatory cytokines in children with febrile convulsions. Pediatr Neurol. 2001;24:49-53. FULL TEXT | ISI | PUBMED
8. Kanemoto K, Kawasaki J, Miyamoto T, Obayashi H, Nishimura M. Interleukin (IL) 1beta, IL-1alpha, and IL-1 receptor antagonist gene polymorphisms in patients with temporal lobe epilepsy. Ann Neurol. 2000;47:571-574. FULL TEXT | ISI | PUBMED
9. Rossi V, Breviario F, Ghezzi P, Dejana E, Montovani A. Prostacyclin synthesis induced by vascular cells by interleukin-1. Science. 1985;229:174-176. FREE FULL TEXT
10. Demeter J, Messer G, Ramisch S, et al. Polymorphism within the second intron of the IL-1 receptor antagonist gene in patients with hematopoietic malignancies. Cytokines Mol Ther. 1996;2:239-242. ISI | PUBMED
11. El-Omar EM, Carrington M, Chow WH, et al. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000;404:398-402. FULL TEXT | PUBMED
12. Moos V, Rudwaleit M, Herzog V, Hohlig K, Sieper J, Muller B. Association of genotypes affecting the expression of interleukin-1beta or interleukin-1 receptor antagonist with osteoarthritis. Arthritis Rheum. 2000;43:2417-2422. FULL TEXT | ISI | PUBMED
13. Cantagrel A, Navaux F, Loubet-Lescoulie P, et al. Interleukin-1ß, interleukin-1 receptor antagonist, interleukin-4, and interleukin-10 gene polymorphisms: relationship to occurrence and severity of rheumatoid arthritis. Arthritis Rheum. 1999;42:1093-1100. FULL TEXT | ISI | PUBMED
14. Hsieh YY, Chang CC, Tsai FJ, et al. Polymorphisms for interleukin-1 beta (IL-1 beta)-511 promotor, IL-1 beta exon 5, and IL-1 receptor antagonist: nonassociation with endometriosis. J Assist Reprod Genet. 2001;18:506-511. FULL TEXT | ISI | PUBMED
15. Pociot F, Molvig J, Wogensen L, et al. A TaqI polymorphism in the human interleukin-1ß (IL-1ß) gene correlates with IL-1ß secretion in vitro. Eur J Clin Invest. 1992;22:396-402. ISI | PUBMED
16. Garcia-Velasco JA, Arici A. Chemokines and human reproduction. Fertil Steril. 1999;71:983-993. FULL TEXT | ISI | PUBMED
17. Dinarello CA. Interleukin 1. Rev Infect Dis. 1984;6:51-95. ISI | PUBMED
18. Tutuncuoglu S, Kutukculer N, Kepe L, Coker C, Berdeli A, Tekgul H. Proinflammatory cytokines, prostaglandins and zinc in febrile convulsions. Pediatr Int. 2001;43:235-239. FULL TEXT | ISI | PUBMED
19. Ichiyama T, Nishikawa M, Yoshitomi T, Hayashi T, Furukawa S. Tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6 in cerebrospinal fluid from children with prolonged febrile seizures: comparison with acute encephalitis/encephalopathy. Neurology. 1998;50:407-411. FREE FULL TEXT
20. Kwok PY, Gu Z. Single nucleotide polymorphism libraries: why and how are we building them? Mol Med Today. 1999;5:538-543. FULL TEXT | ISI | PUBMED
21. Robertson SA, Seamark RF. The role of cytokines in gestation. Crit Rev Immunol. 1994;14:239-292. ISI | PUBMED
22. Copeland NG, Silan CM, Kingsley DM, et al. Chromosomal location of murine and human IL-1 receptor genes. Genomics. 1991;9:44-50. FULL TEXT | ISI | PUBMED
23. Mark LL, Haffajee AD, Socransky SS, et al. Effect of the interleukin-1 genotype on monocyte IL-1beta expression in subjects with adult periodontitis. J Periodontal Res. 2000;35:172-177. FULL TEXT | ISI | PUBMED
24. Licastro F, Pedrini S, Ferri C, et al. Gene polymorphism affecting alpha1-antichymotrypsin and interleukin-1 plasma levels increases Alzheimer's disease risk. Ann Neurol. 2000;48:388-391. FULL TEXT | ISI | PUBMED
25. Nishimura M, Mizuta I, Mizuta E, Yamasaki S, Ohta M, Kuno S. Influence of interleukin-1beta gene polymorphisms on age-at-onset of sporadic Parkinson's disease. Neurosci Lett. 2000;284:73-76. FULL TEXT | ISI | PUBMED
26. Katila H, Hanninen K, Hurme M. Polymorphisms of the interleukin-1 gene complex in schizophrenia. Mol Psychiatry. 1999;4:179-181. FULL TEXT | ISI | PUBMED
27. Son K, Tomita Y, Shimizu T, Nishinarita S, Sawada S, Horie T. Abnormal IL-1 receptor antagonist production in patients with polymyositis and dermatomyositis. Intern Med. 2000;39:128-135. ISI | PUBMED
28. Kantarci OH, Atkinson EJ, Hebrink DD, McMurray CT, Weinshenker BG. Association of two variants in IL-1beta and IL-1 receptor antagonist genes with multiple sclerosis. J Neuroimmunol. 2000;106:220-227. FULL TEXT | ISI | PUBMED
29. Hulkkonen J, Vilpo J, Vilpo L, Koski T, Hurme M. Interleukin-1 beta, interleukin-1 receptor antagonist and interleukin-6 plasma levels and cytokine gene polymorphisms in chronic lymphocytic leukemia: correlation with prognostic parameters. Haematologica. 2000;85:600-606. FREE FULL TEXT
30. Dewberry R, Holden H, Crossman D, Francis S. Interleukin-1 receptor antagonist expression in human endothelial cells and atherosclerosis. Arterioscler Thromb Vasc Biol. 2000;20:2394-2400. FREE FULL TEXT
31. Francis SE, Camp NJ, Dewberry RM, et al. Interleukin-1 receptor antagonist gene polymorphism and coronary artery disease. Circulation. 1999;99:861-866. FREE FULL TEXT
32. Takamatsu M, Yamauchi M, Maezawa Y, Saito S, Maeyama S, Uchikoshi T. Genetic polymorphisms of interleukin-1beta in association with the development of alcoholic liver disease in Japanese patients. Am J Gastroenterol. 2000;95:1305-1311. ISI | PUBMED
33. Smithies AM, Sargen K, Demaine AG, Kingsnorth AN. Investigation of the interleukin 1 gene cluster and its association with acute pancreatitis. Pancreas. 2000;20:234-240. FULL TEXT | ISI | PUBMED
34. Nemetz A, Kope A, Molnar T, et al. Significant differences in the interleukin-1beta and interleukin-1 receptor antagonist gene polymorphisms in a Hungarian population with inflammatory bowel disease. Scand J Gastroenterol. 1999;34:175-179. FULL TEXT | ISI | PUBMED
35. Shu KH, Lee SH, Cheng CH, Wu MJ, Lian JD. Impact of interleukin-1 receptor antagonist and tumor necrosis factor-alpha gene polymorphism on IgA nephropathy. Kidney Int. 2000;58:783-789. FULL TEXT | ISI | PUBMED
36. Hurme M, Santtila S. IL-1 receptor antagonist (IL-1Ra) plasma levels are co-ordinately regulated by both IL-1Ra and IL-1beta genes. Eur J Immunol. 1998;28:2598-2602. FULL TEXT | ISI | PUBMED
37. Mori H, Sawairi M, Nakagawa M, Itoh N, Wada K, Tamaya T. Expression of interleukin-1 (IL-1) beta messenger ribonucleic acid (mRNA) and IL-1 receptor antagonist mRNA in peritoneal macrophages from patients with endometriosis. Fertil Steril. 1992;57:535-542. ISI | PUBMED
38. Ishii T, Matsuse T, Teramoto S, et al. Neither IL-1beta, IL-1 receptor antagonist, nor TNF-alpha polymorphisms are associated with susceptibility to COPD. Respir Med. 2000;94:847-851. FULL TEXT | ISI | PUBMED
39. Zheng C, Huang DR, Bergenbrant S, et al. Interleukin 6, tumour necrosis factor alpha, interleukin 1beta and interleukin 1 receptor antagonist promoter or coding gene polymorphisms in multiple myeloma. Br J Haematol. 2000;109:39-45. FULL TEXT | ISI | PUBMED
40. Kristiansen OP, Pociot F, Johannesen J, et al. Linkage disequilibrium testing of four interleukin-1 gene-cluster polymorphisms in Danish multiplex families with insulin-dependent diabetes mellitus. Cytokine. 2000;12:171-175. FULL TEXT | ISI | PUBMED
41. Bajnok E, Takacs I, Vargha P, Speer G, Nagy Z, Lakatos P. Lack of association between interleukin-1 receptor antagonist protein gene polymorphism and bone mineral density in Hungarian postmenopausal women. Bone. 2000;27:559-562. PUBMED
42. Manzoli A, Andreotti F, Varlotta C, et al. Allelic polymorphism of the interleukin-1 receptor antagonist gene in patients with acute or stable presentation of ischemic heart disease. Cardiologia. 1999;44:825-830. PUBMED
43. Santtila S, Savinainen K, Hurme M. Presence of the IL-1RA allele 2 (IL1RN*2) is associated with enhanced IL-1beta production in vitro. Scand J Immunol. 1998;47:195-198. FULL TEXT | ISI | PUBMED
44. Blakemore AIF, Tarlow JK, Cork MJ, Gordon C, Emery P, Duff GW. Interleukin-1 receptor antagonist gene polymorphism as a disease severity factor in systemic lupus erythematosus. Arthritis Rheum. 1994;37:1380-1385. ISI | PUBMED
45. Tarlow JK, Cork MJ, Clay FE, et al. Association between interleukin-1 receptor antagonist gene polymorphism and early and late-onset psoriasis. Br J Dermatol. 1997;136:147-148. ISI | PUBMED
46. Tarlow JK, Clay FE, Cork MJ, et al. Severity of alopecia areata is associated with a polymorphism in the interleukin-1 receptor antagonist gene. J Invest Dermatol. 1994;103:387-390. FULL TEXT | ISI | PUBMED
47. Clay FE, Cork MJ, Tarlow JK, et al. Interleukin-1 receptor antagonist gene polymorphism association with lichen sclerosus. Hum Genet. 1994;94:407-410. ISI | PUBMED
48. Mansfield JC, Holden H, Tarlow JK, et al. Novel genetic association between ulcerative colitis and the anti-inflammatory cytokine interleukin-1 receptor antagonist. Gastroenterology. 1994;106:637-642. ISI | PUBMED


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter     What's this?

RELATED ARTICLE

Simple Febrile Seizures: Do Polymorphisms of the Interleukin 1 Gene Cluster Simplify Our Understanding?
David B. Lewis
Arch Pediatr Adolesc Med. 2002;156(6):529-530.
EXTRACT | FULL TEXT  


THIS ARTICLE HAS BEEN CITED BY OTHER ARTICLES

Relationship between five common viruses and febrile seizure in children
Chung and Wong
Arch. Dis. Child. 2007;92:589-593.
ABSTRACT | FULL TEXT  

Interleukin-1{alpha}, Interleukin-1{beta}, and Interleukin-1Ra Polymorphisms in Febrile Seizures
Haspolat et al.
J Child Neurol 2005;20:565-568.
ABSTRACT  

Influenza-Associated Encephalopathy and Febrile Convulsions
Millichap
AAP Grand Rounds 2003;10:69-70.
FULL TEXT  

Genetics of temporal lobe epilepsy
Vadlamudi et al.
J. Neurol. Neurosurg. Psychiatry 2003;74:1359-1361.
FULL TEXT  

Simple Febrile Seizures: Do Polymorphisms of the Interleukin 1 Gene Cluster Simplify Our Understanding?
Lewis
Arch Pediatr Adolesc Med 2002;156:529-530.
FULL TEXT  





HOME | CURRENT ISSUE | PAST ISSUES | TOPIC COLLECTIONS | SUBMIT | SUBSCRIBE | HELP
CONDITIONS OF USE | PRIVACY POLICY | CONTACT US | SITE MAP
 
© 2002 American Medical Association. All Rights Reserved.